Skip to main content

pLJM1-zeo-2xStrep-BFLF1
(Plasmid #162661)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162661 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLJM1
  • Backbone size w/o insert (bp) 7034
  • Total vector size (bp) 8585
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BFLF1
  • Species
    EBV (HHV-4)
  • Insert Size (bp)
    1551
  • Promoter CMV
  • Tag / Fusion Protein
    • N-terminal 2xStrep-Tag II (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ggatctctgctgtccctgtaataaacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-zeo-2xStrep-BFLF1 was a gift from Britt Glaunsinger (Addgene plasmid # 162661 ; http://n2t.net/addgene:162661 ; RRID:Addgene_162661)
  • For your References section:

    A pentameric protein ring with novel architecture is required for herpesviral packaging. Didychuk AL, Gates SN, Gardner MR, Strong LM, Martin A, Glaunsinger BA. Elife. 2021 Feb 8;10. pii: 62261. doi: 10.7554/eLife.62261. 10.7554/eLife.62261 PubMed 33554858