pX330 NC-FKBP-Cas9
(Plasmid
#162725)
-
PurposeMammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC ori vector, pX330-U6-Chimeric_BB-CBh-hSpCas9
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP F36V
-
SpeciesH. sapiens (human)
-
Insert Size (bp)642
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330 NC-FKBP-Cas9 was a gift from Amit Choudhary (Addgene plasmid # 162725 ; http://n2t.net/addgene:162725 ; RRID:Addgene_162725) -
For your References section:
Chemogenetic System Demonstrates That Cas9 Longevity Impacts Genome Editing Outcomes. Sreekanth V, Zhou Q, Kokkonda P, Bermudez-Cabrera HC, Lim D, Law BK, Holmes BR, Chaudhary SK, Pergu R, Leger BS, Walker JA, Gifford DK, Sherwood RI, Choudhary A. ACS Cent Sci. 2020 Dec 23;6(12):2228-2237. doi: 10.1021/acscentsci.0c00129. Epub 2020 Nov 18. 10.1021/acscentsci.0c00129 PubMed 33376784