Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #162730)


Item Catalog # Description Quantity Price (USD)
Plasmid 162730 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Please use strain BL21 (DE3) for expression studies
  • Copy number
    High Copy


  • Gene/Insert name
    FKBP F36V
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Tags / Fusion Proteins
    • SUMO (N terminal on insert)
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET SUMO NL-FKBP-Cas9 was a gift from Amit Choudhary (Addgene plasmid # 162730 ; ; RRID:Addgene_162730)
  • For your References section:

    Chemogenetic System Demonstrates That Cas9 Longevity Impacts Genome Editing Outcomes. Sreekanth V, Zhou Q, Kokkonda P, Bermudez-Cabrera HC, Lim D, Law BK, Holmes BR, Chaudhary SK, Pergu R, Leger BS, Walker JA, Gifford DK, Sherwood RI, Choudhary A. ACS Cent Sci. 2020 Dec 23;6(12):2228-2237. doi: 10.1021/acscentsci.0c00129. Epub 2020 Nov 18. 10.1021/acscentsci.0c00129 PubMed 33376784