pU6 SgRNA RBM20
(Plasmid
#162735)
-
PurposeMammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMLM3636, BPK1520
-
Backbone manufacturerJoung lab (Addgene Plasmid #65777)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpacer sequence for RBM20
-
gRNA/shRNA sequenceGGTCTCGTAGTCCGGTGAGC
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6 SgRNA RBM20 was a gift from Amit Choudhary (Addgene plasmid # 162735 ; http://n2t.net/addgene:162735 ; RRID:Addgene_162735) -
For your References section:
Chemogenetic System Demonstrates That Cas9 Longevity Impacts Genome Editing Outcomes. Sreekanth V, Zhou Q, Kokkonda P, Bermudez-Cabrera HC, Lim D, Law BK, Holmes BR, Chaudhary SK, Pergu R, Leger BS, Walker JA, Gifford DK, Sherwood RI, Choudhary A. ACS Cent Sci. 2020 Dec 23;6(12):2228-2237. doi: 10.1021/acscentsci.0c00129. Epub 2020 Nov 18. 10.1021/acscentsci.0c00129 PubMed 33376784