p1.1-eGFP
(Plasmid
#162738)
-
PurposeFluorescent reporter for CHO cells expression studies
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep1.1
-
Backbone manufacturerLMBT, LTD
- Backbone size w/o insert (bp) 11914
- Total vector size (bp) 12628
-
Modifications to backboneAbsI-NheI restriction
-
Vector typeMammalian Expression
-
Selectable markersHT/MTX
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced green fluorescent protein
-
Alt nameeGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)735
-
Mutationconsensus Kozak sequence (GCCGCCATGG) added before the ORF
-
GenBank IDAAB02576.1
- Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AbsI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
- 3′ sequencing primer IRESA-rev aggtttccgggccctcacattg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe eGFP ORF obtained by PCR with pEGFPN2 (Clontech) as a template
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1.1-eGFP was a gift from Ivan Vorobiev (Addgene plasmid # 162738 ; http://n2t.net/addgene:162738 ; RRID:Addgene_162738) -
For your References section:
Improved elongation factor-1 alpha-based vectors for stable high-level expression of heterologous proteins in Chinese hamster ovary cells. Orlova NA, Kovnir SV, Hodak JA, Vorobiev II, Gabibov AG, Skryabin KG. BMC Biotechnol. 2014 Jun 14;14:56. doi: 10.1186/1472-6750-14-56. 10.1186/1472-6750-14-56 PubMed 24929670