p1.1-eGFP
(Plasmid #162738)

• Purpose: Fluorescent reporter for CHO cells expression studies
• Depositing Lab: Ivan Vorobiev
• Publication: Orlova et al BMC Biotechnol. 2014 Jun 14;14:56. doi: 10.1186/1472-6750-14-56.

Backbone

• Vector backbone: p1.1
• Backbone manufacturer: LMBT, LTD
• Backbone size w/o insert (bp): 11914
• Total vector size (bp): 12628
• Modifications to backbone: AbsI-NheI restriction
• Vector type: Mammalian Expression
• Selectable markers: HT/MTX

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: enhanced green fluorescent protein
• Alt name: eGFP
• Species: Aequorea victoria
• Insert Size (bp): 735
• Mutation: consensus Kozak sequence (GCCGCCATGG) added before the ORF
• GenBank ID: AAB02576.1
• Promoter: CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AbsI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: SQ-5CH6-F GCCGCTGCTTCCTGTGAC
• 3′ sequencing primer: IRESA-rev aggtttccgggccctcacattg

Resource Information

• Supplemental Documents:
  • p1.1-eGFP.gb
• A portion of this plasmid was derived from a plasmid made by: The eGFP ORF obtained by PCR with pEGFPN2 (Clontech) as a template

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry