Skip to main content

p1.1-Tr2-eGFP
(Plasmid #162782)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162782 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 162782-D50 50 μg of DNA in Tris buffer $495
DNA 162782-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    p1.1
  • Backbone manufacturer
    LMBT, LTD
  • Backbone size w/o insert (bp) 11914
  • Total vector size (bp) 7436
  • Modifications to backbone
    Truncated EEF1A1 DFR and UFR sequences
  • Vector type
    Mammalian Expression
  • Selectable markers
    HT/MTX

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    enhanced green fluorescent protein
  • Alt name
    eGFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    735
  • Mutation
    consensus Kozak sequence (GCCGCCATGG) added before the ORF
  • GenBank ID
    AAB02576.1
  • Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AbsI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
  • 3′ sequencing primer IRESA rev aggtttccgggccctcacattg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The eGFP ORF obtained by PCR with pEGFPN2 (Clontech) as a template

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p1.1-Tr2-eGFP was a gift from Ivan Vorobiev (Addgene plasmid # 162782 ; http://n2t.net/addgene:162782 ; RRID:Addgene_162782)
  • For your References section:

    High-level expression of the monomeric SARS-CoV-2 S protein RBD 320-537 in stably transfected CHO cells by the EEF1A1-based plasmid vector. Sinegubova MV, Orlova NA, Kovnir SV, Dayanova LK, Vorobiev II. PLoS One. 2021 Feb 2;16(2):e0242890. doi: 10.1371/journal.pone.0242890. eCollection 2021. 10.1371/journal.pone.0242890 PubMed 33529230