Skip to main content

pTF
(Plasmid #162784)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162784 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p1.1
  • Backbone manufacturer
    LMBT, LTD
  • Backbone size (bp) 11914
  • Modifications to backbone
    Truncated EEF1A1 DFR and UFR sequences; FLAG-tag and 10xHis-tag coding sequences added
  • Vector type
    Mammalian Expression
  • Promoter CHO Elongation factor 1A
  • Selectable markers
    HT/MTX
  • Tags / Fusion Proteins
    • FLAG (C terminal on backbone)
    • 10xHis (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
  • 3′ sequencing primer IRESA rev aggtttccgggccctcacattg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTF was a gift from Ivan Vorobiev (Addgene plasmid # 162784 ; http://n2t.net/addgene:162784 ; RRID:Addgene_162784)
  • For your References section:

    Fast and Accurate Surrogate Virus Neutralization Test Based on Antibody-Mediated Blocking of the Interaction of ACE2 and SARS-CoV-2 Spike Protein RBD. Kolesov DE, Sinegubova MV, Dayanova LK, Dolzhikova IV, Vorobiev II, Orlova NA. Diagnostics (Basel). 2022 Feb 3;12(2). pii: diagnostics12020393. doi: 10.3390/diagnostics12020393. 10.3390/diagnostics12020393 PubMed 35204485