pTF
(Plasmid
#162784)
-
Purpose(Empty Backbone) Protein expression in CHO cells - C-terminal FLAG and 10xhis tags are coded
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep1.1
-
Backbone manufacturerLMBT, LTD
- Backbone size (bp) 11914
-
Modifications to backboneTruncated EEF1A1 DFR and UFR sequences; FLAG-tag and 10xHis-tag coding sequences added
-
Vector typeMammalian Expression
- Promoter CHO Elongation factor 1A
-
Selectable markersHT/MTX
-
Tags
/ Fusion Proteins
- FLAG (C terminal on backbone)
- 10xHis (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
- 3′ sequencing primer IRESA rev aggtttccgggccctcacattg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTF was a gift from Ivan Vorobiev (Addgene plasmid # 162784 ; http://n2t.net/addgene:162784 ; RRID:Addgene_162784) -
For your References section:
Fast and Accurate Surrogate Virus Neutralization Test Based on Antibody-Mediated Blocking of the Interaction of ACE2 and SARS-CoV-2 Spike Protein RBD. Kolesov DE, Sinegubova MV, Dayanova LK, Dolzhikova IV, Vorobiev II, Orlova NA. Diagnostics (Basel). 2022 Feb 3;12(2). pii: diagnostics12020393. doi: 10.3390/diagnostics12020393. 10.3390/diagnostics12020393 PubMed 35204485