pHYP-NPC-10H
(Plasmid
#162789)
-
PurposeSARS-CoV-2 Nucleocapsid Protein expression in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5369
-
Modifications to backboneHok/Sok element added, Rop-element deleted
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha for cloning, BL21(DE3) for protein induction
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNucleocapsid phosphoprotein [Severe acute respiratory syndrome coronavirus 2]
-
Alt nameNP
-
SpeciesSevere acute respiratory syndrome coronavirus 2
-
Insert Size (bp)1293
-
GenBank IDYP_009724397.2
-
Entrez GeneN (a.k.a. GU280_gp10)
- Promoter T7lac
-
Tag
/ Fusion Protein
- 10xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI/PciI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7prom TAATACGACTCACTATAGGG
- 3′ sequencing primer T7term GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert DNA was synthesized by Twist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHYP-NPC-10H was a gift from Ivan Vorobiev (Addgene plasmid # 162789 ; http://n2t.net/addgene:162789 ; RRID:Addgene_162789) -
For your References section:
Antigenic properties of the SARS-CoV-2 nucleoprotein are altered by the RNA admixture. Kolesov DE, Sinegubova MV, Safenkova IV, Vorobiev II, Orlova NA. PeerJ. 2022 Jan 7;10:e12751. doi: 10.7717/peerj.12751. eCollection 2022. 10.7717/peerj.12751 PubMed 35036106