Skip to main content

lentiCRISPR v2-Nr4a1 double gRNAs
(Plasmid #162791)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162791 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Addgene 52961
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13364
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Multiplex Nr4a1 gRNA 1 and 2
  • gRNA/shRNA sequence
    gRNA1: CCGGGTAGCAGCCGTACACC; gRNA 2: GTCCAAGTGTGCCCGGATGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nr4a1 (a.k.a. GFRP1, Gfrp, Hbr-1, Hbr1, Hmr, N10, NGFI-B, NGFIB, NP10, NUR77-1, NUR77-2, TIS1, TR3, nur77)
  • Promoter hU6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-Nr4a1 double gRNAs was a gift from Matthew Steinhauser (Addgene plasmid # 162791 ; http://n2t.net/addgene:162791 ; RRID:Addgene_162791)
  • For your References section:

    Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. Zhang Y, Federation AJ, Kim S, O'Keefe JP, Lun M, Xiang D, Brown JD, Steinhauser ML. J Clin Invest. 2018 Nov 1;128(11):4898-4911. doi: 10.1172/JCI98353. Epub 2018 Oct 2. 10.1172/JCI98353 PubMed 30277475