pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
(Plasmid
#162877)
-
PurposeExpression in mammalian cells of Plekstrin-homology domain of Phospholipase C delta tagged with mEos2 to perform sptPALM
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmEos2-N1
-
Backbone manufacturerEGFP replaced with mEos2 in pEGFP-N1 backbone (Clontec)
- Backbone size w/o insert (bp) 4694
- Total vector size (bp) 5198
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepleckstrin homology domain of PLCδ1 (phospholipase C-δ1)
-
Alt namePH-PLCd
-
SpeciesH. sapiens (human)
-
Insert Size (bp)510
-
MutationInsert consists of AA1-170
-
GenBank IDNM_006225.4
-
Entrez GenePLCD1 (a.k.a. NDNC3, PLC-III)
-
Tag
/ Fusion Protein
- mEos2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (CMV F)
- 3′ sequencing primer TGTACCATCTCCGTCGATCA (mEos2 R)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPH-PLCd insert was derived from PH-PLCD1-GFP (Plasmid #51407).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2) was a gift from Frederic Meunier (Addgene plasmid # 162877 ; http://n2t.net/addgene:162877 ; RRID:Addgene_162877) -
For your References section:
Modular transient nanoclustering of activated beta2-adrenergic receptors revealed by single-molecule tracking of conformation-specific nanobodies. Gormal RS, Padmanabhan P, Kasula R, Bademosi AT, Coakley S, Giacomotto J, Blum A, Joensuu M, Wallis TP, Lo HP, Budnar S, Rae J, Ferguson C, Bastiani M, Thomas WG, Pardon E, Steyaert J, Yap AS, Goodhill GJ, Hilliard MA, Parton RG, Meunier FA. Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117. 10.1073/pnas.2007443117 PubMed 33214152