pAT9676-ABE
(Plasmid
#162997)
-
Purposeplasmid expressing ABE
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABE
-
Alt nameadenine base editor
-
SpeciesSynthetic
- Promoter EF1-a
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TATAAGTGCAGTAGTCGCCG
- 3′ sequencing primer TGCTGGCCTTTTGCTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT9676-ABE was a gift from Ervin Welker (Addgene plasmid # 162997 ; http://n2t.net/addgene:162997 ; RRID:Addgene_162997) -
For your References section:
BEAR reveals that increased fidelity variants can successfully reduce the mismatch tolerance of adenine but not cytosine base editors. Talas A, Simon DA, Kulcsar PI, Varga E, Krausz SL, Welker E. Nat Commun. 2021 Nov 3;12(1):6353. doi: 10.1038/s41467-021-26461-y. 10.1038/s41467-021-26461-y PubMed 34732717