-
PurposeFLiCRE protease for neuronal expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-CaM-uTEVp
-
SpeciesSynthetic
- Promoter Synapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGACCATCTGCGCTGCGGCGCC
- 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-CaM-uTEVp was a gift from Alice Ting (Addgene plasmid # 163032 ; http://n2t.net/addgene:163032 ; RRID:Addgene_163032) -
For your References section:
A Molecular Calcium Integrator Reveals a Striatal Cell Type Driving Aversion. Kim CK, Sanchez MI, Hoerbelt P, Fenno LE, Malenka RC, Deisseroth K, Ting AY. Cell. 2020 Dec 23;183(7):2003-2019.e16. doi: 10.1016/j.cell.2020.11.015. Epub 2020 Dec 11. 10.1016/j.cell.2020.11.015 PubMed 33308478