pMOS018E: Entry vector for: ratiometric pHluorin (mitchondrial)
(Plasmid
#163070)
-
PurposeEntry vector for: ratiometric pHluorin (mitchondrial)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepENTR
- Backbone size w/o insert (bp) 2586
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameratiometric pHluorin
-
SpeciesSynthetic
-
Insert Size (bp)822
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTAG
- 3′ sequencing primer ATGGCTCATAACACCCCTTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGero Miesenboeck
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see PMID: 9671304 for original reporter gene characterization.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOS018E: Entry vector for: ratiometric pHluorin (mitchondrial) was a gift from Adam Cohen (Addgene plasmid # 163070 ; http://n2t.net/addgene:163070 ; RRID:Addgene_163070) -
For your References section:
Multiplexed Optical Sensors in Arrayed Islands of Cells for multimodal recordings of cellular physiology. Werley CA, Boccardo S, Rigamonti A, Hansson EM, Cohen AE. Nat Commun. 2020 Aug 4;11(1):3881. doi: 10.1038/s41467-020-17607-5. 10.1038/s41467-020-17607-5 PubMed 32753572