Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA-Fah_W
(Plasmid #163087)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163087 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5506
  • Total vector size (bp) 6764
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Fah_W
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1258
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc-His (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-Fah_W was a gift from Joseph Takahashi (Addgene plasmid # 163087 ; http://n2t.net/addgene:163087 ; RRID:Addgene_163087)
  • For your References section:

    Tissue-specific FAH deficiency alters sleep-wake patterns and results in chronic tyrosinemia in mice. Yang S, Siepka SM, Cox KH, Kumar V, de Groot M, Chelliah Y, Chen J, Tu B, Takahashi JS. Proc Natl Acad Sci U S A. 2019 Oct 29;116(44):22229-22236. doi: 10.1073/pnas.1904485116. Epub 2019 Oct 14. 10.1073/pnas.1904485116 PubMed 31611405