Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lentiGuide-Hygro-mTagBFP2
(Plasmid #99374)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99374 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiGuide ( plasmid #52963)
  • Backbone size w/o insert (bp) 9465
  • Total vector size (bp) 11391
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    S. pyogenes sgRNA cassette
  • Species
    Synthetic
  • Insert Size (bp)
    100
  • Promoter hU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBⅠ (not destroyed)
  • 3′ cloning site BsmBⅠ (not destroyed)
  • 5′ sequencing primer hU6-F
  • 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3')
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Hygro-P2A-mTagBFP2
  • Insert Size (bp)
    1826
  • Promoter EF-1a

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Hygro: Addgene plasmid #61426 (Feng Zhang lab) mTagBFP2: Addgene plasmid #34632 (Vladislav Verkhusha lab)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Hygro sequence is from Addgene plasmid #61426 (generously shared by Feng Zhang Lab). "Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.", Konermann et al.. 2014

mTagBFP2 sequence is from Addgene plasmid #34632 (generously shared by Vladislav Verkhusha Lab). "An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore. ", Subach et al.. 2014

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuide-Hygro-mTagBFP2 was a gift from Kristen Brennand (Addgene plasmid # 99374 ; http://n2t.net/addgene:99374 ; RRID:Addgene_99374)
  • For your References section:

    Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 10.1016/j.stemcr.2017.06.012 PubMed 28757163