Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lenti-EF1a-dCas9-VPR-Puro
(Plasmid #99373)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99373 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9192
  • Total vector size (bp) 15702
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin, Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    (Sp)dCas9-VPR-P2A-Puro
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic; ; S. pyogenes
  • Insert Size (bp)
    6510
  • Promoter EF-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9-VPR: Addgene plasmid #63798 (George Church lab)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

dCas9-VPR sequence is from Addgene plasmid #63798 (generously shared by George Church Lab). "Highly efficient Cas9-mediated transcriptional programming. ", Chavez et al.. 2015

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-EF1a-dCas9-VPR-Puro was a gift from Kristen Brennand (Addgene plasmid # 99373 ; http://n2t.net/addgene:99373 ; RRID:Addgene_99373)
  • For your References section:

    Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 10.1016/j.stemcr.2017.06.012 PubMed 28757163