-
Purpose3rd generation lenti vector encoding dCas9 (S. pyogenes) fused with VP64-p65-Rta (VPR) and 2A puromycin resistance marker; EF1a-dCas9-VPR-P2A-Puro-WPRE)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9192
- Total vector size (bp) 15702
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin, Zeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name(Sp)dCas9-VPR-P2A-Puro
-
SpeciesH. sapiens (human), M. musculus (mouse), Synthetic; ; S. pyogenes
-
Insert Size (bp)6510
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9-VPR: Addgene plasmid #63798 (George Church lab)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
dCas9-VPR sequence is from Addgene plasmid #63798 (generously shared by George Church Lab). "Highly efficient Cas9-mediated transcriptional programming. ", Chavez et al.. 2015
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-EF1a-dCas9-VPR-Puro was a gift from Kristen Brennand (Addgene plasmid # 99373 ; http://n2t.net/addgene:99373 ; RRID:Addgene_99373) -
For your References section:
Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 10.1016/j.stemcr.2017.06.012 PubMed 28757163