pJW1927
(Plasmid
#163093)
-
PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDONR221
- Backbone size w/o insert (bp) 2360
-
Vector typeWorm Expression, Cre/Lox, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet-I^SEC (Lox511I)^TEV::AID*::3xFLAG
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)6748
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
- 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.05.12.090217v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1927 was a gift from Jordan Ward (Addgene plasmid # 163093 ; http://n2t.net/addgene:163093 ; RRID:Addgene_163093) -
For your References section:
An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson BR, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006. 10.1093/genetics/iyab006 PubMed 33677541