Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKLV2-U6gRNA5(NT)-PGKpuro2ABFP-W
(Plasmid #163169)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163169 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
  • Total vector size (bp) 8650
  • Modifications to backbone
    Used BbsI enzyme to clone in non-targeting gRNA
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Non-targeting
  • gRNA/shRNA sequence
    GGGAGGTGGCTTTAGGTTTT
  • Species
    H. sapiens (human)
  • Promoter U6
  • Tag / Fusion Protein
    • BFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(NT)-PGKpuro2ABFP-W was a gift from Sok Ching Cheong (Addgene plasmid # 163169 ; http://n2t.net/addgene:163169 ; RRID:Addgene_163169)
  • For your References section:

    Genome-wide CRISPR screens of oral squamous cell carcinoma reveal fitness genes in the Hippo pathway. Chai AWY, Yee PS, Price S, Yee SM, Lee HM, Tiong VK, Goncalves E, Behan FM, Bateson J, Gilbert J, Tan AC, McDermott U, Garnett MJ, Cheong SC. Elife. 2020 Sep 29;9. pii: 57761. doi: 10.7554/eLife.57761. 10.7554/eLife.57761 PubMed 32990596