Skip to main content
Addgene

pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W
(Plasmid #163172)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163172 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
  • Total vector size (bp) 8650
  • Modifications to backbone
    Used BbsI enzyme to clone in gRNA targeting human YAP1 gene
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YAP1
  • gRNA/shRNA sequence
    GCCCACAGGGAGGCGTCAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter U6
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W was a gift from Sok Ching Cheong (Addgene plasmid # 163172 ; http://n2t.net/addgene:163172 ; RRID:Addgene_163172)
  • For your References section:

    Genome-wide CRISPR screens of oral squamous cell carcinoma reveal fitness genes in the Hippo pathway. Chai AWY, Yee PS, Price S, Yee SM, Lee HM, Tiong VK, Goncalves E, Behan FM, Bateson J, Gilbert J, Tan AC, McDermott U, Garnett MJ, Cheong SC. Elife. 2020 Sep 29;9. pii: 57761. doi: 10.7554/eLife.57761. 10.7554/eLife.57761 PubMed 32990596