PX459v2-ILK-gRNA 2-exon 8
(Plasmid
#163321)
-
PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 9200
-
Modifications to backboneUsed BbsI sites to insert 21bp gRNA
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameILK gRNA 2_Exon8
-
Alt nameguide RNA targeting Integrin-Linked Kinase, exon 8
-
gRNA/shRNA sequenceG*ACATTGTAGAGGGATCCATA
-
SpeciesH. sapiens (human)
- Promoter U6F
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddGene, pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459v2-ILK-gRNA 2-exon 8 was a gift from Val Brunton (Addgene plasmid # 163321 ; http://n2t.net/addgene:163321 ; RRID:Addgene_163321) -
For your References section:
Loss of Integrin-linked kinase sensitizes breast cancer to SRC inhibitors. Beetham H, Griffith BGC, Murina O, Loftus AE, Parry DA, Temps C, Culley J, Muir M, Unciti-Broceta A, Sims AH, Byron A, Brunton VG. Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373. 10.1158/0008-5472.CAN-21-0373 PubMed 34921014