pMX-mPGK-CD90.2-Cd247A_miR
(Plasmid
#163327)
-
PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the murine PGK promoter.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMX
-
Vector typeMammalian Expression, Retroviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD90.2
-
Alt nameThy1b
-
gRNA/shRNA sequenceCCTCTTCATCTACGGAGTCAT
-
SpeciesM. musculus (mouse)
-
Entrez GeneThy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)
- Promoter mPGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.08.425881v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-mPGK-CD90.2-Cd247A_miR was a gift from Louis Ates & Teunis Geijtenbeek (Addgene plasmid # 163327 ; http://n2t.net/addgene:163327 ; RRID:Addgene_163327) -
For your References section:
An optimized retroviral toolbox for overexpression and genetic perturbation of primary lymphocytes. van der Donk LEH, van der Spek J, van Duivenvoorde T, Ten Brink MS, Geijtenbeek TBH, Kuijl CP, van Heijst JWJ, Ates LS. Biol Open. 2022 Feb 15;11(2):bio059032. doi: 10.1242/bio.059032. Epub 2022 Mar 1. 10.1242/bio.059032 PubMed 35229875