pLVX-RT001-LVB
(Plasmid
#163381)
-
PurposeSecond generation lentiviral vector to express anti-GFP(LaG17) module in the G-baToN system
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX
- Backbone size w/o insert (bp) 8102
- Total vector size (bp) 10176
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLaG17-VEEGFRtm-BFP (LVB)
-
SpeciesSynthetic
-
Insert Size (bp)1400
- Promoter EF1A
-
Tag
/ Fusion Protein
- BFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer GGTGTCGTGAGGATCTATTTCCG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-RT001-LVB was a gift from Monte Winslow (Addgene plasmid # 163381 ; http://n2t.net/addgene:163381 ; RRID:Addgene_163381) -
For your References section:
A versatile system to record cell-cell interactions. Tang R, Murray CW, Linde IL, Kramer NJ, Lyu Z, Tsai MK, Chen LC, Cai H, Gitler AD, Engleman E, Lee W, Winslow MM. Elife. 2020 Oct 7;9. pii: 61080. doi: 10.7554/eLife.61080. 10.7554/eLife.61080 PubMed 33025906