Skip to main content

pLVX-RT007-GCN4scFV-VB
(Plasmid #163387)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163387 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX
  • Backbone size w/o insert (bp) 8102
  • Total vector size (bp) 10533
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    antiGCN4scFV-VEEGFRtm-BFP (GCN4scFV-VB)
  • Species
    Synthetic
  • Promoter EF1a
  • Tag / Fusion Protein
    • BFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer GGTGTCGTGAGGATCTATTTCCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-RT007-GCN4scFV-VB was a gift from Monte Winslow (Addgene plasmid # 163387 ; http://n2t.net/addgene:163387 ; RRID:Addgene_163387)
  • For your References section:

    A versatile system to record cell-cell interactions. Tang R, Murray CW, Linde IL, Kramer NJ, Lyu Z, Tsai MK, Chen LC, Cai H, Gitler AD, Engleman E, Lee W, Winslow MM. Elife. 2020 Oct 7;9. pii: 61080. doi: 10.7554/eLife.61080. 10.7554/eLife.61080 PubMed 33025906