Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #163446)


Item Catalog # Description Quantity Price (USD)
Plasmid 163446 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Mutation
    See: comments
  • Entrez Gene
    GPT (a.k.a. AAT1, ALT1, GPT1)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert sequence is a codon-optimized gBLOCK (IDT); further contains the following silent mutation versus gBLOCK sequence: T291C

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJC2-GPT1-3xFLAG was a gift from Jason Cantor (Addgene plasmid # 163446 ; ; RRID:Addgene_163446)
  • For your References section:

    CRISPR screens in physiologic medium reveal conditionally essential genes in human cells. Rossiter NJ, Huggler KS, Adelmann CH, Keys HR, Soens RW, Sabatini DM, Cantor JR. Cell Metab. 2021 Feb 23. pii: S1550-4131(21)00061-9. doi: 10.1016/j.cmet.2021.02.005. 10.1016/j.cmet.2021.02.005 PubMed 33651980