Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #16345)

Full plasmid sequence is not available for this item.



Item Catalog # Description Quantity Price (USD)
Plasmid 16345 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
    Adenoviral Recombinant (pAdEasy)
  • Backbone size w/o insert (bp) 33400
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • Mutation
    Functional Ca2+binding site CD was inactivated by substituting a glutamate for a valine residue at position 12 of Ca2+ binding loop
  • GenBank ID
  • Entrez Gene
    Pvalb (a.k.a. PALB1, Pva)
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GTGGCAAAAGTGACGTTTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

AdEasy is a registered trademark of the Johns Hopkins University.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd-PV-NLS-CD-DsRed was a gift from Anton Bennett (Addgene plasmid # 16345 ; ; RRID:Addgene_16345)
  • For your References section:

    Nucleoplasmic calcium is required for cell proliferation. Rodrigues MA, Gomes DA, Leite MF, Grant W, Zhang L, Lam W, Cheng YC, Bennett AM, Nathanson MH. J Biol Chem. 2007 Jun 8. 282(23):17061-8. 10.1074/jbc.M700490200 PubMed 17420246