Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #163517)


Item Catalog # Description Quantity Price (USD)
Plasmid 163517 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Modifications to backbone
    Changed multiple cloning site
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    murine-IFN gamma
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Ifng (a.k.a. IFN-g, If, If2f, Ifg)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (unknown if destroyed)
  • 3′ cloning site Not1 (unknown if destroyed)
  • 5′ sequencing primer CGTTTAGTGAACCGTCAGATC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Plasmid created by Ananda Mookerjee and Thomas Weber

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mu-IFNg-pCIneo was a gift from Thomas Weber (Addgene plasmid # 163517 ; ; RRID:Addgene_163517)