mu-FLT3Lv1-pTRIP
(Plasmid
#163519)
-
PurposeUsed to construct lentivirus to express murine FLT3 ligand (variant-1) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRIP-Puro-2A
-
Backbone manufacturerAddgene
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemurine-FLT3L variant 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)765
-
GenBank IDNM_013520.3
-
Entrez GeneFlt3l (a.k.a. Flt3lg, Ly72L)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer TTTGGCAGTACACCAATGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid created by Ananda Mookerjee and Thomas Weber
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mu-FLT3Lv1-pTRIP was a gift from Thomas Weber (Addgene plasmid # 163519 ; http://n2t.net/addgene:163519 ; RRID:Addgene_163519)