Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mu-FLT3Lv1-pTRIP
(Plasmid #163519)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163519 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRIP-Puro-2A
  • Backbone manufacturer
    Addgene
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    murine-FLT3L variant 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    765
  • GenBank ID
    NM_013520.3
  • Entrez Gene
    Flt3l (a.k.a. Flt3lg, Ly72L)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer TTTGGCAGTACACCAATGGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid created by Ananda Mookerjee and Thomas Weber

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mu-FLT3Lv1-pTRIP was a gift from Thomas Weber (Addgene plasmid # 163519 ; http://n2t.net/addgene:163519 ; RRID:Addgene_163519)