MSCV-BCL2
(Plasmid
#163611)
-
PurposeOverexpression of human BCL2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV_IRES_huDC2
- Backbone size w/o insert (bp) 6574
- Total vector size (bp) 7304
-
Modifications to backboneBCL2 was cloned into MSCV_IRES_huDC2 using Gibson Assembly
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBCL2
-
Alt nameB-Cell CLL/Lymphoma 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)722
-
GenBank IDNM_000633
-
Entrez GeneBCL2 (a.k.a. Bcl-2, PPP1R50)
- Promoter LTR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTATCCAGCCCTCAC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The huCD2 portion of the MSCV_IRES_huDC2 backbone was added by Dr Martin Turner, Babraham Institute, Cambridge by modification of Addgene plasmid # 27490.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-BCL2 was a gift from Daniel Hodson (Addgene plasmid # 163611 ; http://n2t.net/addgene:163611 ; RRID:Addgene_163611) -
For your References section:
Genetic modification of primary human B cells to model high-grade lymphoma. Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x. 10.1038/s41467-019-12494-x PubMed 31586074