MSCV-BCL2
(Plasmid #163611)

• Purpose: Overexpression of human BCL2
• Depositing Lab: Daniel Hodson
• Publication: Caeser et al Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x.

Backbone

• Vector backbone: MSCV_IRES_huDC2
• Backbone size w/o insert (bp): 6574
• Total vector size (bp): 7304
• Modifications to backbone: BCL2 was cloned into MSCV_IRES_huDC2 using Gibson Assembly
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BCL2
• Alt name: B-Cell CLL/Lymphoma 2
• Species: H. sapiens (human)
• Insert Size (bp): 722
• GenBank ID: NM_000633
• Entrez Gene: BCL2 (a.k.a. Bcl-2, PPP1R50)
• Promoter: LTR

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTTATCCAGCCCTCAC
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• Supplemental Documents:
  • 163611 genbank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The huCD2 portion of the MSCV_IRES_huDC2 backbone was added by Dr Martin Turner, Babraham Institute, Cambridge by modification of Addgene plasmid # 27490.