p10xQUAS-CsChrimson
(Plasmid
#163629)
-
Purpose10xQUAS effector expressing CsChrimson.mVenus for red-shifted optogenetic activation of neurons; Contains both P-element ends and attB integration sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep10QUAS
-
Backbone manufacturersynthetic- Potter Lab
- Backbone size w/o insert (bp) 8335
- Total vector size (bp) 10676
-
Modifications to backboneincludes P-element sites for P-element transposase insertion; also includes attB site for integration into attP genomic sites
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCsChrimson.mVenus
-
Alt nameCsChrimson
-
SpeciesSynthetic
-
Insert Size (bp)1875
-
Tag
/ Fusion Protein
- mVenus (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCGTCTACGGAGCGACAATTCAATTCAAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPCR amplified from genomic DNA of UAS-CsChrimson flies.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2020.11.07.355651v2
Also refer to: Klapoetke, N.C., Murata, Y., Kim, S.S., Pulver, S.R., Birdsey-Benson, A., Cho, Y.K., Morimoto, T.K., Chuong, A.S., Carpenter, E.J., Tian, Z., et al. (2014). Independent optical excitation of distinct neural populations. Nat Methods 11, 338-346. PMID: 24509633, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3943671/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p10xQUAS-CsChrimson was a gift from Christopher Potter (Addgene plasmid # 163629 ; http://n2t.net/addgene:163629 ; RRID:Addgene_163629) -
For your References section:
Chemoreceptor co-expression in Drosophila melanogaster olfactory neurons. Task D, Lin CC, Vulpe A, Afify A, Ballou S, Brbic M, Schlegel P, Raji J, Jefferis G, Li H, Menuz K, Potter CJ. Elife. 2022 Apr 20;11. pii: 72599. doi: 10.7554/eLife.72599. 10.7554/eLife.72599 PubMed 35442190