-
Purpose(Empty Backbone) Optimized M. tuberculosis CRISPRi plasmid; L5 integrating.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene #115162
-
Backbone manufacturerRock Lab
- Backbone size (bp) 8631
-
Vector typeBacterial Expression, CRISPR
- Promoter Tet-On
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsShake at 220rpm. For best yield, grow for >16 hours.
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 3′ sequencing primer TTCCTGTGAAGAGCCATTGATAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plRL2 was a gift from Jeremy Rock (Addgene plasmid # 163631 ; http://n2t.net/addgene:163631 ; RRID:Addgene_163631) -
For your References section:
Genome-wide gene expression tuning reveals diverse vulnerabilities of M. tuberculosis. Bosch B, DeJesus MA, Poulton NC, Zhang W, Engelhart CA, Zaveri A, Lavalette S, Ruecker N, Trujillo C, Wallach JB, Li S, Ehrt S, Chait BT, Schnappinger D, Rock JM. Cell. 2021 Jul 16. pii: S0092-8674(21)00824-2. doi: 10.1016/j.cell.2021.06.033. 10.1016/j.cell.2021.06.033 PubMed 34297925