Skip to main content
Addgene

pRM27
(Plasmid #163695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163695 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pminiTol2
  • Backbone manufacturer
    Stephen Ekker (Plasmid #31829)
  • Backbone size w/o insert (bp) 7065
  • Total vector size (bp) 7805
  • Modifications to backbone
    ubb promoter inserted at BamHI site, lck:mNeonGreen inserted between BamHI and ClaI
  • Vector type
    Zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lck:mNeonGreen
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    740
  • Entrez Gene
    lck (a.k.a. zgc:136695)
  • Promoter ubb
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRM27 was a gift from David Matus (Addgene plasmid # 163695 ; http://n2t.net/addgene:163695 ; RRID:Addgene_163695)
  • For your References section:

    Visualizing the metazoan proliferation-quiescence decision in vivo. Adikes RC, Kohrman AQ, Martinez MAQ, Palmisano NJ, Smith JJ, Medwig-Kinney TN, Min M, Sallee MD, Ahmed OB, Kim N, Liu S, Morabito RD, Weeks N, Zhao Q, Zhang W, Feldman JL, Barkoulas M, Pani AM, Spencer SL, Martin BL, Matus DQ. Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265. 10.7554/eLife.63265 PubMed 33350383