pRM27
(Plasmid #163695)

• Purpose: ubb promoter driven expression of lck:mNeonGreen
• Depositing Lab: David Matus
• Publication: Adikes et al Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265.

Backbone

• Vector backbone: pminiTol2
• Backbone manufacturer: Stephen Ekker (Plasmid #31829)
• Backbone size w/o insert (bp): 7065
• Total vector size (bp): 7805
• Modifications to backbone: ubb promoter inserted at BamHI site, lck:mNeonGreen inserted between BamHI and ClaI
• Vector type: Zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: lck:mNeonGreen
• Species: D. rerio (zebrafish)
• Insert Size (bp): 740
• Entrez Gene: lck (a.k.a. zgc:136695)
• Promoter: ubb
• Tag / Fusion Protein:
  • mNeonGreen (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTAATACGACTCACTATAGGG
• 3′ sequencing primer: ATTAACCCTCACTAAAGGGA

Resource Information

• Supplemental Documents:
  • pRM27_Tol2_ubi_Lck_mNG_NGS.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry