AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP
(Plasmid
#163701)
-
PurposeDox-inducible SOX2-3xHA HDR knock-in cassette into the AAVS1 locus with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAVS1
- Backbone size w/o insert (bp) 8691
- Total vector size (bp) 10512
-
Modifications to backboneInserted T2-sgRNA target sequence (23bp) into SspI cut site to induce plasmid linearized inside the cell.
-
Vector typeMammalian Expression, AAV, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSOX2-3xHA-P2A-tagBFP
-
Alt nameANOP3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1821
-
GenBank IDNM_003106
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
- Promoter TRE3G
-
Tags
/ Fusion Proteins
- 3x-HA (C terminal on insert)
- P2A-tagBFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
- 3′ sequencing primer TGTGGAATTGTGAGCGGATA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namertTA
-
SpeciesSynthetic
-
Insert Size (bp)853
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
- 3′ sequencing primer CAGAGGGAAAAAGATCTCAGT (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameT2-sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)23
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SspI (destroyed during cloning)
- 3′ cloning site SspI (destroyed during cloning)
- 5′ sequencing primer agtggaggaagacggaacct
- 3′ sequencing primer agcaaaaacaggaaggcaaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid backbone was modified from Addgene Plasmid #73497 to insert the SOX2-3xHA-P2A-tagBFP cassette. sgRNA T2 target sequence (ggggccactagggacaggattgg) was cloned from Addgene Plasmid #72833 into the SspI cutsite in order to induce plasmid linearization inside the cell. Use this construct together with Addgene Plasmid #72833 to induce AAVS1 HDR integration.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP was a gift from Jennifer Mitchell (Addgene plasmid # 163701 ; http://n2t.net/addgene:163701 ; RRID:Addgene_163701) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673