Skip to main content

gRNA_SOX2_HDR
(Plasmid #163752)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163752 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    gRNA_Cloning Vector
  • Backbone size w/o insert (bp) 3915
  • Total vector size (bp) 3975
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA_SOX2
  • gRNA/shRNA sequence
    CCGGACAGCGAACTGGAGGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA_Cloning Vector backbone (Addgene Plasmid #41824) was used to insert the human SOX2 target sequence (CCGGACAGCGAACTGGAGGG). Once this construct is expressed together with Cas9 (Addgene Plasmid #41815), it will induce a double-strand break around the SOX2 stop codon to allow HDR repair with a knock-in template (Addgene Plasmid #163751).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA_SOX2_HDR was a gift from Jennifer Mitchell (Addgene plasmid # 163752 ; http://n2t.net/addgene:163752 ; RRID:Addgene_163752)
  • For your References section:

    Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673