gRNA_SOX2_HDR
(Plasmid
#163752)
-
PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonegRNA_Cloning Vector
- Backbone size w/o insert (bp) 3915
- Total vector size (bp) 3975
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA_SOX2
-
gRNA/shRNA sequenceCCGGACAGCGAACTGGAGGG
-
SpeciesH. sapiens (human)
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA_Cloning Vector backbone (Addgene Plasmid #41824) was used to insert the human SOX2 target sequence (CCGGACAGCGAACTGGAGGG). Once this construct is expressed together with Cas9 (Addgene Plasmid #41815), it will induce a double-strand break around the SOX2 stop codon to allow HDR repair with a knock-in template (Addgene Plasmid #163751).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA_SOX2_HDR was a gift from Jennifer Mitchell (Addgene plasmid # 163752 ; http://n2t.net/addgene:163752 ; RRID:Addgene_163752) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673