VPS35 shRNA1
(Plasmid
#163858)
-
PurposeshRNA targeting the coding sequences of VPS35
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerD. Root (Addgene #10878)
- Backbone size w/o insert (bp) 7026
- Total vector size (bp) 7084
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS35 retromer complex component
-
gRNA/shRNA sequenceAATCAGCGGATTCGCTTCACA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_018206
-
Entrez GeneVPS35 (a.k.a. MEM3, PARK17)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer 5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’ (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VPS35 shRNA1 was a gift from Lei Lu (Addgene plasmid # 163858 ; http://n2t.net/addgene:163858 ; RRID:Addgene_163858) -
For your References section:
A quantitative study of the Golgi retention of glycosyltransferases. Sun X, Mahajan D, Chen B, Song Z, Lu L. J Cell Sci. 2021 Oct 15;134(20). pii: 272560. doi: 10.1242/jcs.258564. Epub 2021 Oct 21. 10.1242/jcs.258564 PubMed 34533190