Skip to main content

pXPR-SF61
(Plasmid #163916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163916 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC
  • Backbone size w/o insert (bp) 4005
  • Total vector size (bp) 4926
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SF5Phe tRNA synthetase
  • Species
    Synthetic
  • Insert Size (bp)
    921
  • Promoter araBAD

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR-SF61 was a gift from Thomas Huber (Addgene plasmid # 163916 ; http://n2t.net/addgene:163916 ; RRID:Addgene_163916)
  • For your References section:

    Genetic Encoding of para-Pentafluorosulfanyl Phenylalanine: A Highly Hydrophobic and Strongly Electronegative Group for Stable Protein Interactions. Qianzhu H, Welegedara AP, Williamson H, McGrath AE, Mahawaththa MC, Dixon NE, Otting G, Huber T. J Am Chem Soc. 2020 Oct 14;142(41):17277-17281. doi: 10.1021/jacs.0c07976. Epub 2020 Sep 30. 10.1021/jacs.0c07976 PubMed 32975937