Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pXPR-SF61
(Plasmid #163916)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163916 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACYC
  • Backbone size w/o insert (bp) 4005
  • Total vector size (bp) 4926
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SF5Phe tRNA synthetase
  • Species
    Synthetic
  • Insert Size (bp)
    921
  • Promoter araBAD

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR-SF61 was a gift from Thomas Huber (Addgene plasmid # 163916 ; http://n2t.net/addgene:163916 ; RRID:Addgene_163916)
  • For your References section:

    Genetic Encoding of para-Pentafluorosulfanyl Phenylalanine: A Highly Hydrophobic and Strongly Electronegative Group for Stable Protein Interactions. Qianzhu H, Welegedara AP, Williamson H, McGrath AE, Mahawaththa MC, Dixon NE, Otting G, Huber T. J Am Chem Soc. 2020 Oct 14;142(41):17277-17281. doi: 10.1021/jacs.0c07976. Epub 2020 Sep 30. 10.1021/jacs.0c07976 PubMed 32975937