pXPR-SF61
(Plasmid
#163916)
-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of para-Pentafluorosulfanyl-Phenylalanine, into proteins in E. coli in response to the amber (TAG) codon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACYC
- Backbone size w/o insert (bp) 4005
- Total vector size (bp) 4926
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSF5Phe tRNA synthetase
-
SpeciesSynthetic
-
Insert Size (bp)921
- Promoter araBAD
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR-SF61 was a gift from Thomas Huber (Addgene plasmid # 163916 ; http://n2t.net/addgene:163916 ; RRID:Addgene_163916) -
For your References section:
Genetic Encoding of para-Pentafluorosulfanyl Phenylalanine: A Highly Hydrophobic and Strongly Electronegative Group for Stable Protein Interactions. Qianzhu H, Welegedara AP, Williamson H, McGrath AE, Mahawaththa MC, Dixon NE, Otting G, Huber T. J Am Chem Soc. 2020 Oct 14;142(41):17277-17281. doi: 10.1021/jacs.0c07976. Epub 2020 Sep 30. 10.1021/jacs.0c07976 PubMed 32975937