Human a3 nicotinic receptor subunit EM construct
(Plasmid
#163960)
-
PurposepEZT-BM vector with alpha3 gene after CMV promoter, published EM construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEZT-BM
-
Backbone manufacturerHibbs Lab
- Total vector size (bp) 8657
-
Vector typeMammalian Expression ; Baculovirus (bacmam) production and mammalian expression
-
Selectable markersmEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman alpha3 nicotinic acetylcholine receptor subunit EM construct
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1671
-
MutationAsn348-Ser402 replaced with apocytochrome b(562)RIL (BRIL)
- Promoter CMV
-
Tag
/ Fusion Protein
- apocytochrome b(562)RIL (BRIL)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ttgcctttctctccacaggt
- 3′ sequencing primer gccatacgggaagcaatagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human a3 nicotinic receptor subunit EM construct was a gift from Ryan Hibbs (Addgene plasmid # 163960 ; http://n2t.net/addgene:163960 ; RRID:Addgene_163960) -
For your References section:
Agonist Selectivity and Ion Permeation in the alpha3beta4 Ganglionic Nicotinic Receptor. Gharpure A, Teng J, Zhuang Y, Noviello CM, Walsh RM Jr, Cabuco R, Howard RJ, Zaveri NT, Lindahl E, Hibbs RE. Neuron. 2019 Nov 6;104(3):501-511.e6. doi: 10.1016/j.neuron.2019.07.030. Epub 2019 Sep 2. 10.1016/j.neuron.2019.07.030 PubMed 31488329