Skip to main content

Human b4 nicotinic receptor subunit EM construct
(Plasmid #163961)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163961 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEZT-BM
  • Backbone manufacturer
    Hibbs Lab
  • Total vector size (bp) 8657
  • Vector type
    Mammalian Expression ; Baculovirus (bacmam) production and mammalian expression
  • Selectable markers
    mEGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human beta4 nicotinic acetylcholine receptor subunit EM construct
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1680
  • Mutation
    Pro341-Ser395 replaced with apocytochrome b(562)RIL (BRIL)
  • Promoter CMV
  • Tags / Fusion Proteins
    • apocytochrome b(562)RIL (BRIL)
    • StrepII tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ttgcctttctctccacaggt
  • 3′ sequencing primer gccatacgggaagcaatagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human b4 nicotinic receptor subunit EM construct was a gift from Ryan Hibbs (Addgene plasmid # 163961 ; http://n2t.net/addgene:163961 ; RRID:Addgene_163961)
  • For your References section:

    Agonist Selectivity and Ion Permeation in the alpha3beta4 Ganglionic Nicotinic Receptor. Gharpure A, Teng J, Zhuang Y, Noviello CM, Walsh RM Jr, Cabuco R, Howard RJ, Zaveri NT, Lindahl E, Hibbs RE. Neuron. 2019 Nov 6;104(3):501-511.e6. doi: 10.1016/j.neuron.2019.07.030. Epub 2019 Sep 2. 10.1016/j.neuron.2019.07.030 PubMed 31488329