Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA™5/FRT/CMV_promoter-ciCas9-E2A-mRFP
(Plasmid #164132)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164132 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5-FRT
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 10381
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ciCas9
  • Alt name
    Chemically inducible SpCas9
  • Species
    Synthetic
  • Insert Size (bp)
    6050
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcgtggaacaacacaaacactacc
  • 3′ sequencing primer ttctttaagcagtccttccctgagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA™5/FRT/CMV_promoter-ciCas9-E2A-mRFP was a gift from Hyongbum Kim (Addgene plasmid # 164132 ; http://n2t.net/addgene:164132 ; RRID:Addgene_164132)
  • For your References section:

    Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780