Lenti-pHSE::Cre-mRuby3
(Plasmid
#164136)
-
PurposeLentiviral construct for building stable cell lines expressing Cre recombinase and mRuby3 in the presence of heat induction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCas9-Blast plasmid (Addgene #52962)
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 9864
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSE promoter-Cre-T2A-mRuby3
-
Alt nameHeat shock element
-
Alt nameCre recombinase
-
SpeciesSynthetic
- Promoter HSE synthetic promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-pHSE::Cre-mRuby3 was a gift from Hyongbum Kim (Addgene plasmid # 164136 ; http://n2t.net/addgene:164136 ; RRID:Addgene_164136) -
For your References section:
Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780