- 
            PurposeDoxycycline inducible expression of Cyclin E1
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCW57.1
- Backbone size w/o insert (bp) 9354
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersBlasticidin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameCCNE1
- 
                  Alt nameCyclin E1
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1233
- 
                    GenBank IDNM_001238.4
- 
                        Entrez GeneCCNE1 (a.k.a. CCNE, pCCNE1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer LNCX
- 3′ sequencing primer GAACGGACGTGAAGAATGTG (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCW57.1 CCNE1 was a gift from Richard Possemato (Addgene plasmid # 164144 ; http://n2t.net/addgene:164144 ; RRID:Addgene_164144)
