Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV Syn CaMPARI2-human-a-Tubulin (TubuTag)
(Plasmid #164184)


Item Catalog # Description Quantity Price (USD)
Plasmid 164184 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 7275
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Syn
  • Tags / Fusion Proteins
    • NES (N terminal on insert)
    • 6 His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Bsp1407I (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Human α Tubulin
  • Alt name
    h a Tubulin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter Syn

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ctattttaagcagtcgtttc
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CaMPARI2 was a kind gift from Eric Schreiter, Janelia farm USA Marina Mikhaylove Lab provided us kindly with the Human α Tubulin
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Syn CaMPARI2-human-a-Tubulin (TubuTag) was a gift from Thomas Oertner (Addgene plasmid # 164184 ; ; RRID:Addgene_164184)
  • For your References section:

    Freeze-Frame Imaging of Dendritic Calcium Signals With TubuTag. Alvarez AP, Huhn F, Durst CD, Franzelin A, Molina P and Oertner TG. Front. Mol. Neurosci., 04 March 2021 10.3389/fnmol.2021.635820