pAAV Syn CaMPARI2-human-a-Tubulin (TubuTag)
(Plasmid #164184)

• Purpose: Freeze-frame imaging of dendritic calcium signals CaMPARI2 moiety with lower Ca+ affinity (Kd=199nM) (Moeyaert et al., 2018)
• Depositing Lab: Thomas Oertner
• Publication: Alvarez et al Front. Mol. Neurosci., 04 March 2021

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4579
• Total vector size (bp): 7275
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CamPARI2
• Species: Synthetic
• Insert Size (bp): 1306
• Promoter: Syn
• Tags / Fusion Proteins:
  • NES (N terminal on insert)
  • 6 His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: Bsp1407I (not destroyed)
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: CTTGTACATTGAGCTCAGCCGACCTATAG

Gene/Insert 2

• Gene/Insert name: Human α Tubulin
• Alt name: h a Tubulin
• Species: H. sapiens (human)
• Insert Size (bp): 1353
• Promoter: Syn

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ctattttaagcagtcgtttc
• 3′ sequencing primer: GGCATTAAAGCAGCGTATCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The CaMPARI2 was a kind gift from Eric Schreiter, Janelia farm USA Marina Mikhaylove Lab provided us kindly with the Human α Tubulin
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry