pLENTI CMV GFP-TREX1 309* BLAST
(Plasmid
#164242)
-
Purposelentiviral plasmid for GFP-TREX1 309*
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti CMV GFP Blast
- Backbone size w/o insert (bp) 8372
- Total vector size (bp) 9299
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTREX1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)897
-
Mutationdeletion of amino acids 310-314
-
GenBank IDNM_033629.6
-
Entrez GeneTREX1 (a.k.a. AGS1, CRV, DRN3, HERNS, RVCLS)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggacgacggcaactacaagac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLENTI CMV GFP-TREX1 309* BLAST was a gift from John Maciejowski (Addgene plasmid # 164242 ; http://n2t.net/addgene:164242 ; RRID:Addgene_164242) -
For your References section:
ER-directed TREX1 limits cGAS activation at micronuclei. Mohr L, Toufektchan E, von Morgen P, Chu K, Kapoor A, Maciejowski J. Mol Cell. 2021 Jan 12. pii: S1097-2765(20)30958-8. doi: 10.1016/j.molcel.2020.12.037. 10.1016/j.molcel.2020.12.037 PubMed 33476576