Skip to main content

pU6-TREX1 g3 Cas9-T2A-mCherry
(Plasmid #164252)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164252 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6 Cas9-T2A-mCherry
  • Backbone size w/o insert (bp) 9265
  • Total vector size (bp) 9284
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgTREX1
  • gRNA/shRNA sequence
    CCTCATCTTTTTCGACATGG
  • Insert Size (bp)
    19
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-TREX1 g3 Cas9-T2A-mCherry was a gift from John Maciejowski (Addgene plasmid # 164252 ; http://n2t.net/addgene:164252 ; RRID:Addgene_164252)
  • For your References section:

    ER-directed TREX1 limits cGAS activation at micronuclei. Mohr L, Toufektchan E, von Morgen P, Chu K, Kapoor A, Maciejowski J. Mol Cell. 2021 Jan 12. pii: S1097-2765(20)30958-8. doi: 10.1016/j.molcel.2020.12.037. 10.1016/j.molcel.2020.12.037 PubMed 33476576