Skip to main content
Addgene

pHSG1C3
(Plasmid #164423)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164423 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Derived from pSB1C3
  • Backbone manufacturer
    Registry of Standard Biological Parts
  • Total vector size (bp) 2481
  • Modifications to backbone
    U6 promoter, sgRNA scaffold and restriction cloning sites.
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • Alt name
    single guide RNA
  • gRNA/shRNA sequence
    Non-targeted guide, BbsI restriction sites.
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI or PstI (unknown if destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer AATACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHSG1C3 was a gift from Xiao Wang (Addgene plasmid # 164423 ; http://n2t.net/addgene:164423 ; RRID:Addgene_164423)
  • For your References section:

    Prime Editing Guide RNA Design Automation Using PINE-CONE. Standage-Beier K, Tekel SJ, Brafman DA, Wang X. ACS Synth Biol. 2021 Feb 19;10(2):422-427. doi: 10.1021/acssynbio.0c00445. Epub 2021 Jan 19. 10.1021/acssynbio.0c00445 PubMed 33464043