pHSG1C3
(Plasmid
#164423)
-
Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneDerived from pSB1C3
-
Backbone manufacturerRegistry of Standard Biological Parts
- Total vector size (bp) 2481
-
Modifications to backboneU6 promoter, sgRNA scaffold and restriction cloning sites.
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
Alt namesingle guide RNA
-
gRNA/shRNA sequenceNon-targeted guide, BbsI restriction sites.
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI or PstI (unknown if destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer AATACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHSG1C3 was a gift from Xiao Wang (Addgene plasmid # 164423 ; http://n2t.net/addgene:164423 ; RRID:Addgene_164423) -
For your References section:
Prime Editing Guide RNA Design Automation Using PINE-CONE. Standage-Beier K, Tekel SJ, Brafman DA, Wang X. ACS Synth Biol. 2021 Feb 19;10(2):422-427. doi: 10.1021/acssynbio.0c00445. Epub 2021 Jan 19. 10.1021/acssynbio.0c00445 PubMed 33464043