Skip to main content

pCS2+methylated-reporter
(Plasmid #164491)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164491 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4692
  • Vector type
    Production of mRNA for zebrafish injection.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A-less CDS, HA tag, 12x m6A motif 3'UTR
  • Insert Size (bp)
    597
  • Promoter SP6
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCTTGATTTAGGTGACACTATA
  • 3′ sequencing primer M13 reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+methylated-reporter was a gift from Antonio Giraldez (Addgene plasmid # 164491 ; http://n2t.net/addgene:164491 ; RRID:Addgene_164491)
  • For your References section:

    Ythdf m(6)A Readers Function Redundantly during Zebrafish Development. Kontur C, Jeong M, Cifuentes D, Giraldez AJ. Cell Rep. 2020 Dec 29;33(13):108598. doi: 10.1016/j.celrep.2020.108598. 10.1016/j.celrep.2020.108598 PubMed 33378672