pUltraI-Tet3.0[TAA]
(Plasmid
#164580)
-
PurposeMachinery plasmid containing a single copy of the Mb Tet3.0RS and cognate tRNA for incorporation of Tet3.0 at TAA codons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUltraI
- Backbone size w/o insert (bp) 3965
- Total vector size (bp) 5297
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMb Tet3.0RS (R2-3)
-
Alt nameTet3.0RS
-
SpeciesMethanosarcina barkeri (engineered)
-
Insert Size (bp)1260
-
MutationL170G, N311G, C313A
- Promoter TacI
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCTCTCCCTTATGCGACTCCTG
- 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMm tRNA[TAA]
-
Alt nametRNA[TTA]
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)72
- Promoter ProK
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGGCCTGCTGACTTTCTCG
- 3′ sequencing primer CAAATTCGACCCTGAGCTGCTCGAGCATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Machinery plasmid for incorporation of Tet3.0 at TAA codons.
Please visit https://doi.org/10.1101/2021.04.12.439361 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUltraI-Tet3.0[TAA] was a gift from Ryan Mehl (Addgene plasmid # 164580 ; http://n2t.net/addgene:164580 ; RRID:Addgene_164580) -
For your References section:
Genetic Incorporation of Two Mutually Orthogonal Bioorthogonal Amino Acids That Enable Efficient Protein Dual-Labeling in Cells. Bednar RM, Jana S, Kuppa S, Franklin R, Beckman J, Antony E, Cooley RB, Mehl RA. ACS Chem Biol. 2021 Nov 19;16(11):2612-2622. doi: 10.1021/acschembio.1c00649. Epub 2021 Sep 30. 10.1021/acschembio.1c00649 PubMed 34590824