pET28-sfGFP[D134TAG+N150TAA]
(Plasmid
#164582)
-
Purposesuperfolder GFP with D134TAG and N150TAA mutations
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28
- Backbone size w/o insert (bp) 5205
- Total vector size (bp) 5952
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP-134TAG+150TAA
-
Insert Size (bp)747
-
MutationD134TAG + N150TAA Mutations
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Production of full-length protein requires dual TAG/TAA suppression machinery.
Please visit https://doi.org/10.1101/2021.04.12.439361 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-sfGFP[D134TAG+N150TAA] was a gift from Ryan Mehl (Addgene plasmid # 164582 ; http://n2t.net/addgene:164582 ; RRID:Addgene_164582) -
For your References section:
Genetic Incorporation of Two Mutually Orthogonal Bioorthogonal Amino Acids That Enable Efficient Protein Dual-Labeling in Cells. Bednar RM, Jana S, Kuppa S, Franklin R, Beckman J, Antony E, Cooley RB, Mehl RA. ACS Chem Biol. 2021 Nov 19;16(11):2612-2622. doi: 10.1021/acschembio.1c00649. Epub 2021 Sep 30. 10.1021/acschembio.1c00649 PubMed 34590824